What nitrogenous bases are found in DNA? A. cytosine, uracil, adenine, thymine B. Thymine,...
Question:
What nitrogenous bases are found in DNA?
A. cytosine, uracil, adenine, thymine
B. Thymine, guanine, uracil, adenine
C. adenine, cytosine, guanine, thymine
Bonds Between Strands of Nitrogenous Bases
There are specific nitrogenous bases that together form a DNA strand. These nitrogenous bases hold the main structure of the DNA together with the help of hydrogen bonds. Proteins are associated with the strand which also helps in the formation of the superstructure of DNA. These nitrogenous bases together form the stable DNA structure and hydrogen bonds keep them together. The stability of the structure is important as the structure maintains the genetic material of the organisms.
Answer and Explanation: 1
Become a Study.com member to unlock this answer! Create your account
View this answerThe four nitrogenous bases which are specific for DNA are C. adenine, cytosine, guanine, thymine.
There are four nucleotides that together form the...
See full answer below.
Ask a question
Our experts can answer your tough homework and study questions.
Ask a question Ask a questionSearch Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
DNA: Chemical Structure of Nucleic Acids & Phosphodiester Bonds
from
Chapter 10 / Lesson 1
31K
Nucleic acids are large biomolecules used to store, transfer and convey genetic information in cells. Explore the structure of nucleotides and what polynucleotide and phosphodiester bonds do.
Related to this Question
- Which of the nitrogenous bases is part of DNA but not RNA? (a) Cytosine. (b) Thymine. (c) Guanine. (d) Uracil.
- Which of the following nitrogenous bases is only found in RNA but NOT in DNA? A. Thymine B. Guanine C. Uracil D. Adenine
- Cytosine,uracil and thymine are single ringed nitrogenous bases called _______________.
- Which nitrogenous bases would be found on the MRNA transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC and why?
- List the four nitrogenous bases found in DNA.
- One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT/TGC/GTA/CTC/ACT. What nitrogenous bases would be found on "the other DNA strand lying along side of it and why?"
- Which bases are found in DNA? In RNA?
- Which of the following is a nitrogen base found ONLY in RNA? a. Thymine b. Uracil c. Deoxyribose d. Adenine e. All of the above except b.
- In the bonding of nitrogenous bases in replication: A. Adenine is paired with cytosine. B. adenine is paired with guanine. C. Cytosine is paired with thymine. D. Guanine is paired with cytosine. E. Uracil is paired with adenine.
- One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC-CGC-CCT-TGC-GTA-CTC-ACT. What nitrogenous bases would be found on the other DNA strand lying alongside it and why?
- Which of the following options is correct? Four of the following are nitrogenous bases of DNA or RNA, while is an amino acid. a. glycine b. adenine c. cytosine d. thymine e. uracil
- Adenine are guanine form a sub-group of nucleotides called _____.
- What are the base pairings in DNA and RNA? And also mention the amount of hydrogen bonds between them.
- The information in DNA is encoded in A. the adenine, thiamine, guanine, and cytosine bases. B. the sugar phosphate backbone. C. the hydrogen bonds. D. the histone proteins.
- What are the DNA-RNA rules of complementary base pairing?
- Nucleic acids a) Are called nucleic acids because they only exist in the nucleus of the cell b) Have hydrogen bonds that dictate pairing of cytosine to guanine and adenine to thymine ( or uracil) in RNA c) Contain a 6 carbon sugar (glucose) d) All the abo
- Nucleic acids a) are called nucleic acids because they only exist in the nucleus of the cell b) have hydrogen bonds that dictate pairing of cytosine to guanine and adenine to thymine (or uracil in RNA) c) contains a 6 carbon sugar (glucose) d) All the a
- If the base sequence on a strand of DNA is TACCCGTATACT, what would be the sequence of the codons on the mRNA transcribed from this DNA?
- What is DNA replication? Include DNA, strands, DNA helicase, DNA polymerase, topoisomerase, nucleotides, hydrogen bonds, base pairs,semi-conservative, and mitosis terms.
- Given the following sequence of DNA nucleotides- Templates DNA - TAC. What will the codon be?
- What is the nucleotide sequence of an mRNA strand that has been transcribed from the DNA sequence GGTAGC? a. TTGCTA b. CCUACG c. CCAUCG d. GGTAGC
- What molecules are composed of a nitrogenous base, a 5-carbon sugar, and a phosphate molecule?
- What are the DNA-DNA rules of complementary base pairing?
- The two polynucleotide strands that make up double-stranded DNA are held together by hydrogen bonds. How many hydrogen bonds connect individual thymine (T) and adenine (A) bases together as a T: A base pair?
- What would the sequence of bases of the anticodons on the tRNA be?
- A triplet of RNA bases that codes fro a specific amino acid is called a _____.
- What is found in a structure of DNA and the structure of RNA?
- How many strands of nucleic acids are there in a DNA molecule ? a. 10 b. 5 c. 4 d. 2
- Explain codon and anticodon and how many amino acid bases are found in each.
- A nucleotide consists of: a. a five-carbon sugar, a nitrogenous base, and a phosphate group. b. a phosphate group and a nitrogenous base. c. a five-carbon sugar and a nitrogenous base. d. a five-carbon sugar and an amino acid. e. a five-carbon sugar and p
- Nucleotides a) consist of a phosphate group, 5-carbon sugar, and an organic nitrogenous base b) are the building blocks for DNA and RNA c) are synthesized throughout the life of an organism d) All the above (a, b and c) are correct
- RNA: A. contains uracil B. contains thymine C. is a double helix D. contains guanine
- Which of the following are components of a nucleotide monomer? a. A six-carbon sugar. b. A phosphate group. c. A nitrogenous base.
- If a section of a DNA template stand contained the sequence TGAGAC, what would be the sequence of bases of the complementary mRNA strand?
- Nucleotides a) consist of the phosphate group, 5-carbon sugar, and an organic nitrogenous base b) are the building blocks of DNA and RNA c) are synthesized throughout the life of an organism d) All the above (a, b, c) are correct.
- Fill in the blank: RNA is different from DNA in that RNA is single-stranded, possesses ribose sugar, and instead of thymine.
- Fill in the blank: The three base sequence on mRNA that matches the triplet of DNA is a(n) ______.
- What is the sugar found in the nucleotides which compose genes called?
- Which enzyme assembles individual nucleotides into DNA or RNA molecules?
- Fill in the blank: Any three base sequence found on the mRNA that codes for a specific amino acid is called a.
- If a protein has 1398 nucleotides how many amino acids will be made?
- What enzymes add ribonucleotides during transcription? a) DNA polymerase b) Primase c) Transcription factor d) RNA polymerase
- One single nucleotide can be found in: (a) ATP (b) DNA (c) RNA.
- What is the complementary mRNA base sequence to the DNA stand TGCCAT? a. TGCCAT b. UGCCAU c. ACGGTA d. ACGGUA e. ACCGTA
- What elements are involved in the structure of nucleic acids?
- A DNA fragment of 1066 base pairs could encode maximally how many amino acids? 266 amino acids 355 amino acids 532 amino acids 1065 amino acids None of the above
- Which of the following is not a nucleotide? a)RNA b)GTP c)ATP d)cAMP
- The basic monomer building block of DNA is a _____. a. amino acid b. nucleic acid c. nucleotide d. monosaccharide e. lipid
- The triplet codes in DNA needed to specify a specific polypeptide chain are found in the: a) cytoplasm. b) gene. c) codon of mRNA. d) anticodon of tRNA.
- Which RNA is shaped like a clover? a. T-RNA. b. R-RNA. c. M-RNA. d. DNA is shaped like a clover, not RNA.
- (a) Explain codon and anticodon. (b) How many amino acids are found in each?
- What is the role of RNA polymerase in transcription? A) RNA polymerase signals the end of the mRNA molecule. B) RNA polymerase catalyzes the unwinding of the DNA double helix. C) RNA polymerase binds the DNA promoter and builds an mRNA molecule. D) RNA
- Molecular biologists have discovered that the amino acid sequence in a protein synthesized is based on sets of three nucleotide bases in messenger RNA called codons. In theory, how many different codons in RNA can be formed by various sequences of nucleot
- a. Which molecule (DNA or RNA) is single-stranded? b. Which molecule is double-stranded?
- Nucleotides, a) consist of a phosphate group, 5-carbon sugar, and an organic nitrogenous base b) must be incorporated into proteins in the process of transcription c) is the same in all cells of the body even though cells' appearance and function differ.
- What is the minimum number of nucleotide bases needed to form the code for one specific amino acid? A. 5 B. 2 C. 3 D. 4
- Which of the following is the genetic information found in the nucleus of the cell (like the cells hard drive)? A Protein B. DNA C. RNA D. sucrose
- The first few triplets in one strand of a DNA gene are, TACAGACGA. The following amino acids are carried by tRNAs with the following anticodons: alanine - tRNA anticodon is CGA. cysteine - tRNA anticodon is ACA. leucine - tRNA anticodon is AAU. methio
- Fill in the blanks: During DNA replication, cytosine always binds to with hydrogen bonds.
- What are: a gene, a codon, an anticodon, the generic code?
- Which do you think formed first - nucleic acid or proteins? Explain.
- Messenger RNA (mRNA) can be best described as: a. a sugar used in DNA. b. a copy of a DNA gene that plays an important role in protein synthesis. c. a pyrimidine. d. a nitrogenous base held together by hydrogen bonds.
- One strand of DNA containing the sequence CAATCGTC would pair up with what sequence on its adjoining strand? A. GTTAGCAG B. AGGCTACA C. TGGCTACT D. ACCGATGA
- What are the 4 nitrogen based in a DNA molecule? What is the sugar used in an ATP molecule?
- Which of the following is associated with DNA to RNA? A. Transcription B. Translation
- During DNA replication, (a) tRNAs bring specific amino acids to an mRNA molecule. (b) amino acids are joined. (c) the DNA double helix comes apart where hydrogen bonds join base pairs, and new nucleotides are brought in, forming two double helices. (d) tw
- A sequence of three bases forms a(n) ________. (a) codon. (b) anticodon. (c) amino acid. (d) polypeptide bond.
- Match each of the following with either DNA or mRNA: 1. Forms a double helix. 2. Contains the codon. 3. Is single-stranded. 4. Can move from the nucleus to the ribosomes. 5. Contains uracil.
- Which of the following codons can only come from a strand of RNA? a) ATG b) TGC c) Two of the answers are correct. d) GCG e) CAU
- How many nucleotides are needed to code for an amino acid? a. one b. two c. three d. four
- What is translation? Include DNA, transcription, gene, mRNA, tRNA, ribosome, rRNA, RNA polymerase, peptide bonds, base pairs, anticodon, codon start codon, and amino acid terms.
- What are the building blocks for protein? a) Amino acids b) Disaccharides c) Nucleotides d) Triglycerides
- What type of bonds hold the complementary base pair of DNA together? A) hydrogen bond B) covalent bond C) ionic bond D) acid-base reaction
- Which of the following options is correct? When mRNA molecules are formed, they are complementary to DNA with the exception that a. an A in DNA matches a T in mRNA. b. a T in DNA matches a C in mRNA. c. an A in DNA matches a G in mRNA. d. an A in DNA matc
- Which substance/molecules is Chromatin made of? What is it bound to?
- What are pathogens consisting of a nucleic acid core and a protein coat?
- DNA replication results in two new DNA molecules/ Each of these new molecules: a. has one strand of nucleotides from the parent DNA and one newly synthesized strand of nucleotides. b. has two strands of nucleotides from the parent. c. has two newly synthe
- 1. The __of the tRNA binds to the __ of the mRNA as the assembling of a polypeptide can begin 2. _ in the nucleoplasm bind to the open-ended nitrogenous bases of DNA
- Name the specific kind of RNA that is complementary to a gene coded in DNA and is ultimately read by ribosomes to create the protein.
- Chromosomes consist of [{Blank}] and [{Blank}]. A) RNA; carbohydrates B) DNA; lipids C) DNA; proteins D) water; RNA E) RNA; proteins
- 1.) What does RNA polymerase do in transcription? 2.) What is the end product of transcription?
- Is DNA found in chromatin throughout the cell life cycle?
- The primary structure of what molecule is read during the following processes? a. DNA replication b. translation c. transcription d. reverse transcription
- All of these are true about the comparisons between DNA and RNA except: (A) DNA contains the bases G, C, A, and T, while RNA contains U instead of T; (B) DNA is a very large molecule compared to RNA (C) both types of nucleic acids tend to be formed into
- What molecules are the monomer form of proteins?
- What mRNA sequence is made from the DNA template strand shown below? a. GCAACAGGCGATTTTGCCAACCGG b. ATGGTGAATAGCCCCAATGGTTAA c. CUTTUTCCUCTAAAACUUTTUUCC d. AUGGUGAAUAGCCCCAAUGGUUAA
- What is the process that occurs when the DNA base sequence is used to make a complementary piece of RNA?
- Fill in the blank: When mRNA molecules are formed, they are complementary to DNA with the exception that ______.
- How many nucleotides long is the unit which encodes a SINGLE amino acid? A. Less than three B. Three C. Anywhere from one to thousands D. There is not enough information to answer the question E. Mulligan
- Fill in the blank: If one side of the DNA strand reads: ATCTCAG, the complementary RNA strand would read.
- Lysine is a positively charged amino acid. How does this property of lysine allow it to interact with DNA? a. Lysine can form covalent bonds with phosphate groups in the DNA backbone. b. Lysine can form covalent bonds with nitrogenous bases in the DNA. c.
- Which of the following does not play a role in DNA replication? A) RNA primer B) Deoxynucleotide C) Stop codon D) DNA polymerase
- Fill in the blank: The type of RNA that has an anticodon is called [{Blank}] RNA.
- Errors in DNA replication are usually detected and corrected by a proofreader molecule of __________. (A) DNA helicase (B) Reverse transcriptase (C) Recombinant DNA (D) DNA polymerase (E) DNA ligase.
- Chromosomes consist of {Blank} and {Blank}. A. water: RNA B. DNA: proteins C. DNA: lipids D. RNA: carbohydrates E. DNA: proteins
- What is an mRNA sequence?
- Fill in the blank: If one side of the DNA strand reads: ATCTCAG, the complementary DNA strand would read.
- Which of the following statements about DNA and RNA is true? a. DNA carries out protein synthesis and RNA directs protein synthesis. b. RNA carries out protein synthesis and DNA directs protein synthesis. c. DNA and RNA both direct protein synthesis. d. R
- The DNA in the cell during interphase is prevented from supercoiling by the actions of [{Blank}]. A. Hydrogen bonds B. Acid pH C. Messenger RNA D. Histone Proteins
- The "genetic code" determines the types of proteins made by a cell. The term "genetic code" refers to A. three-base sequences in DNA that code for a particular amino acid. B. the positioning of phosphate groups and sugar in DNA. C. the order of amino a
Explore our homework questions and answers library
Browse
by subject