The initial native DNA is usually in an overwound state, making the initial strand separation...
Question:
The initial native DNA is usually in an overwound state, making the initial strand separation during replication energetically favorable, with continued strand separation at the replication fork resulting in underwound DNA that is then fixed by DNA gyrase.
a. True.
b. False.
Topoisomerases:
Topoisomerases are essential enzymes for relieving torsional stress in deoxyribonuclease (DNA) strands and untangling replicating DNA. Topoisomerases are basically of two types, Type I topoisomerases split one DNA strand and pass the strands (one or two) through the nick before resealing it, whereas type II enzymes cleave both DNA strands simultaneously and pass another double strand through the gap before religation of the double-strand break.
Answer and Explanation: 1
Become a Study.com member to unlock this answer! Create your account
View this answerThe provided statement is False.
DNA generally exists in a relaxed state (B-conformation) double-stranded helix structure that can duplicate itself...
See full answer below.
Ask a question
Our experts can answer your tough homework and study questions.
Ask a question Ask a questionSearch Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
DNA Replication | How, When & Why?
from
Chapter 4 / Lesson 2
9.9K
Understand how DNA is replicated. Learn why DNA replicates, when DNA replicates, and how DNA replication works. Get an overview of the rates of replication of different cells.
Related to this Question
- In DNA replication, the strand grows towards the replication fork, while the strand grows away from the replication fork. a. mRNA; leading b. leading; lagging c. leading; template d. lagging; template e. lagging; leading
- When DNA replication begins: (a) The 2 DNA strands unwind from each other. (b) The 2 DNA strands condense for the process of base transfer. (c) The 2 DNA molecules bond more tightly. (d) The old strands migrate around the cell in search of new strands.
- Formation of a replication fork results in: A) continuous synthesis of DNA on the lagging strand. B) buildup of torsion in the DNA upstream of the fork. C) formation of new 3' -OH regions on the template DNA. D) binding of SSB protein on the double-str
- A double-stranded DNA molecule has the following sequence: 5' ATCCGGATGTTGCCGGAATGCTGGCGATGACGT 3' 3' TAGGCCTACAACGGCCTTACGACCGCTACTGCA 5' a. Draw the first 10 newly synthesized bases during DNA replication (ignore the origin of replication). b. What is t
- To start DNA replication, the bonds holding the strands together are broken, and the molecule begins to unwind. Which of the following statements best summarizes what happens next? (a) Transformation results in a new DNA molecule. (b) Each old strand acts
- During replication, the role of DNA primase is to _______. (a) add a nucleotide to the growing DNA chain (b) synthesize a short chain for RNA (c) untwists the double helix at the origin of replication (d) relax the supercoiling of the double helix (e) syn
- During DNA replication, a complementary strand of DNA is made for each original DNA strand. Thus, if a portion of the original strand is CCTAGCT, what will be the new strand?
- Place the steps of bacterial chromosomal replication in the correct order. DNA primase synthesizes a primer on both strands. DNA helicase binds to the origin of replication. DNA polymerase III binds to the origin of replication. DNA protein binds to the o
- During replication of DNA, Okazaki fragments are: a.) On the Lagging strand and are made up of RNA primer and short DNA sequences. b.) On the Lagging strand and are processed and joined by DNA ligase to form a continuous strand of DNA. c.) Temporary DNA
- These two systems have evolved within cells to repair double-strand DNA breaks. A. Homologous recombination, nonhomologous end-joining. B. DNA glue, CRISPR Cas 9 C. replication fork collapse, strand invasion. D. Nonhomologous recombination, homolog
- When DNA replication begins, _____. a. the two DNA strands separate b. the two DNA strands condense for base transfers c. old strands move to find new strands d. mutations occur
- DNA replication begins when \\ a) DNA molecules exchange segments\\ b) results in the formation of 4 new DNA strands \\ c) uses each strand of the DNA molecule as a template for the creation of a new strand copies \\ d) DNA into RNA
- In the semiconservative replication of DNA, each of the new double strands of DNA has a) one original strand and one newly assembled strand b) two strands from the original DNA molecule c) two newly assembled strands d) None of these
- DNA replication begins at short stretches of DNA with a specific sequence of nucleotides called: a. Origins of replication b. Template sequence c. Replication fork d. Replication bubble
- In the process of DNA replication, the lagging strand cannot be synthesized continuously because: (a) Helicase cannot unwind DNA sequence that contains telomere sequence. (b) Separation of the parental DNA strands proceeds upstream of and away from the 5'
- In a human germ cell, a replication slippage event occurs during the round of DNA replication just before meiosis. The slippage event occurred within the DNA sequence that encodes for the first exon of the KRT1 gene. The KRT1 gene encodes for the protein
- A portion of one DNA strand has the following sequence (with ORI being an origin of replication): 5' AGG CCT AAC ORI CCA GCC 3' \leftarrow leading strand Which of the following sequences would represent an initial replication product from the leading str
- For DNA Replication, number these in front of the events in the order. *A double helix is separated *Proteins prevent single strands of DNA from rejoining *New nucleotides are added to an RNA primer *The leading strand is synthesized continuously *
- During replication of DNA, Okazaki fragments are: A) On the Lagging strand and are made up of RNA primer and short DNA sequences B) On the Lagging strand and are processed and joined by DNA ligase to form a continuous strand of DNA C) Temporary DNA, so th
- During DNA replication the {Blank} is made continuously. a. phosphodiesterase bonds b. lagging strand c. plasmid d. RNA e. leading strand
- The replication of lagging strands of DNA differs from the replication of leading strands in that: a. DNA ligase is not needed. b. primase is not required. c. DNA synthesis proceeds in the 3-to-5 direction. d. RNA primers are not required. e. DNA is repli
- The statement "DNA replicates by a semiconservative mechanism" means that: a) Only one DNA strand is copied. b) First one DNA strand is copied, and then the other strand is copied. c) The two strands of a double helix have identical base sequences. d) Som
- Helicases untwist the DNA double helix at the replication fork. Why is there a need for another enzyme, the topoisomerase, to act ahead of the replication fork to break and twist and rejoin DNA strands?
- 1. When DNA replication starts (A) The hydrogen bonds between the nucleotides of two strands break. (B) The phosphodiester bonds between the adjacent nucleotides break. (C) The bonds between the nitrogen base and deoxyribose sugar break. (D) The leadi
- During DNA replication, an old DNA strand with base sequence ATCTGAGTA would serve as a template to form a new complementary strand with the base sequence: A) TAGACTCAT B) ATCTGAGTA C) AUCUCUGUA
- During DNA replication, a DNA strand that has the bases GGTCTA produces a strand with the bases: a. TCGAAC b. AGCTTG c. GAUCCA d. CCAGAT
- The holoenzyme explores a length of DNA until it encounters a promoter region and binds to about 60 nucleotide pairs along the double helix, 40 of which are upstream from the point of initial transcription. Once this occurs, the helix is denatured, or u
- The DNA strand that is made continuously is called the A. lagging strand B. Okazaki fragment C. replication machinery D. DNA polymerase E. leading strand
- Which of these occurs first? a. Helicase unwinds DNA b. Sliding clamp binds around DNA c. DnaA binds at the origin of replication d. DNA pol III copies DNA
- Mutations are the original source of genetic variation. How can mutations accumulate in DNA, given that cells have repair systems that fix mispaired nucleotides or breaks in DNA strands?
- Answer the questions for the given original DNA strand, ATCCTAGCC. Explain how you arrived at the answer to each question. 1. Write the complementary strand that will be formed after the replication of the given original DNA strand. 2. Write the cDNA stra
- During DNA replication, proteins unwind the DNA duplex and separate the DNA strands. Those proteins include ______. (a) DNA polymerase and ligase (b) single-stranded DNA binding and protein primase (c) helicase and DNA polymerase (d) helicase and single-s
- A delimitation occurs on the cytosine residue in the following DNA sequence 5'-AGAATTCG-3'. After two cell divisions (hence two rounds of DNA replication) the damage has been fixed as a mutation. The sequence of the same stretch of DNA is now: A. 5'-AG
- 3. A deamination occurs on the cytosine residue in the following DNA sequence 5'-GAATCG-3'. (Note: the top strand is shown; this is the strand where the delamination occurs.) If the mutation is not repaired, and a round of DNA replication occurs, then the
- Which of the following is true about DNA? a) It is a single-stranded molecule. b) Only one of the original DNA strands acts as a template during replication. c) Both of the original DNA strands act
- Shown below is a DNA replication bubble shortly after unwinding via DNA helicase The origin is a bidirectional origin. Indicate if A, B, C, and D will represent the template for either leading or lagging strand synthesis ? B 3" 3 5' 5' 3' ? D
- The following DNA fragment was isolated from the beginning of a gene. GGGATGCGGAAAGTCCAA CCCTACGCCTTTCAGGTT Determine which strand is transcribed, indicate the polarity of the two DNA strands, and then give the sequence of bases in the resulting mRNA a
- At a chromosome replication fork, the lagging strand consists of _____ that are joined by _____. A. RNA sequences; DNA ligase B. Okazaki fragments; RNA polymerase C. RNA sequences; ribosomes D. Okazaki fragments; DNA ligase
- Would DNA replication be much more error prone if DNA polymerases could polymerize two nucleotide triphosphates to start a new DNA strand?
- Describe the steps involved in DNA replication for both the leading and lagging strands in a replication fork starting with the actions of helicase and topoisomerase.
- During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because: A) replication starts at many points on
- The enzyme DNA _____ reads one strand of the original DNA and uses it as a blueprint to "write" a new strand during replication.
- DNA replication happens during the S phase of the cell cycle. Sketch and label the process of DNA replication. In the answer, include leading and lagging strand synthesis as well as indicated the important enzymes and their functions to the process.
- DNA strand: TTTTCGCGATATGCTGGT The following set of protein chains (amino acids) were created by mutating one nucleotide in the DNA strand above. For each of the protein chains, identify the mutation to the DNA strand as a codon deletion, addition, or su
- Transcription begins in the when unzips a DNA molecule. align themselves to complementary base pairs and in this manner, is formed. In , must be processed before it leaves the . One end is modified with the addition of a and the other end is modifi
- Which of the following is not involved in the initiation of replication? a. Ligase b. DNA gyrase c. Single-stranded binding protein d. Primase
- The elongation of the leading strand during DNA replication _______. A. progresses away from the replication fork B. occurs in the 3' --> 5' direction C. produces many Okazaki fragments, which subsequently are joined together D. depends primarily on t
- DNA strand separation during DNA replication is triggered by what?
- UV-induced DNA damage is mainly in the form of: a. transversion mutations b. double-stranded breaks in the DNA c. transition mutations d. dimer formation between adjacent pyrimidine bases on the same DNA strand
- Choose the best answer: During the process of DNA replication in E. coli, the enzyme primase a. connects short segments of DNA together. b. connects the first few nucleotides of each new molecule. c. Opens the helix at the replication fork. d. removes
- The first step in the replication of DNA is catalyzed by _____.
- Eukaryotic DNA replication initiates replication at multiple origins of replication simultaneously. How is eukaryotic replication initiated to ensure simultaneous initiation at multiple origins? a. A Pre-replication complex (preRC) is formed at all hemime
- During DNA replication, DNA ligase is most active on the lagging strand. Explain.
- The immediate result after DNA replication during meiosis results in a. one old strand that came back together after replication and one completely new strand that was just assembled b. two completely new strands of DNA c. two strands of DNA that a
- Which of the following enzymes is the first to bind to the DNA sequences at the origin of replication? (a) DNA primase (b) DNA helicase (c) single-strand binding protein (d) DNA ligase (e) DNA polymerase.
- A classic experiment by Meselson and Stahl demonstrated: a. the semi-discontinuous mode of DNA replication. b. the semi-conservative mode of DNA replication. c. the existence of Okasaki fragments. d. the anti-parallel nature of the structure of DNA.
- Which one is mismatched? a. DNA polymerase III - adds nucleotides to an RNA primer b. Ligase - seals any nicks in the new sugar/phosphate backbone c. Helicase - unwinds the double helix to create replication fork
- Toward the start of DNA replication, what two forms "unfasten" the two strands of DNA?
- The process by which DNA is copied to be passed on to the next generation of an organism is called: a. DNA replication b. DNA unzipping c. Cell division d. Genetic mutation
- An enzyme that seals gaps or breaks in double-stranded DNA is called ______. (a) DNA autosome (b) DNA polymerase (c) DNA replication (d) DNA diploid (e) DNA ligase.
- The double-strand break repair model of recombination requires: a. the formation of two Holliday junctions b. that the unbroken chromosome initiates strand invasion c. strand invasion by a 5'-P tailed single-strand DNA d. a break in both of the chromosome
- One strand of double-stranded DNA is mutated, changing all cytosine's to uracil's. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will be _____. a. be higher b. be lower c. remain the same d. be doub
- DNA repair enzymes preferentially repair mismatched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were instead repaired without regard for which strand served as template, would mismatch repair reduce rep
- Why does DNA replication in E. coli start at oriC? A. DNA polymerase is always found attached to the DNA at the oriC. B. DNA protein is bound to this site. C. DNA clamp is already loaded to the DNA at this location. D. This region of DNA is A-T rich c
- Replication is the process that results in ________. (a) two non-identical DNA by a semi-conservative method (b) two non-identical DNA by random replication (c) two similar DNA through a semi-conservative method (d) one DNA molecule.
- During this stage in transcription, the polymerase advances 3' to 5' down the template strand, melting duplex DNA and adding rNTPs to growing RNA. A.Elongation. B.Synthesis. C.Initiation. D.Termination.
- One strand of a single DNA helix is labeled red while the other strand of the same DNA helix is labeled blue. This double helix DNA is replicated through the process of semi-conservative replication. Note that a completely newly synthesized strand of DNA
- A strand of a single DNA helix is labeled red, while the other strand of the same DNA helix is labeled blue. This double helix DNA is replicated through the process of semi-conservative replication. Note that a completely newly synthesized strand of DNA w
- If a strand of DNA of sequence 5 -TGGACCTAGACC-3 is replicated, what is the newly synthesized DNA strand?
- Draw a DNA replication process in a eukaryotic cell. On your drawing, label: a. Origin. b. Directionality (5' and 3' ends) of all template and newly synthesized strands. c. Leading and lagging strands. d. Okazaki fragments. e. RNA primers.
- Topoisomerases: a) synthesize DNA b) synthesize RNA primers c) join Okazaki fragments d) break and rejoin DNA to reduce torsional strain e) prevent single DNA strands from joining to form a double helix
- Describe how DNA replication is initiated, including how the DNA is made accessible for replication, and the molecules that are involved in permitting the initial generation of replicated DNA.
- Place the following steps of DNA replication in the correct chronological order. 1. Primase adds a ribonucleotide primer. 2. Initiator proteins bind the origin of replication and helicase breaks hydrogen bonds between complementary bases of double-strande
- DNA polymerases are not able to prime replication, yet primase and other RNA polymerases can. Some geneticists have speculated that the inability of DNA polymerase to prime replication is due to its proofreading function. This hypothesis argues that proof
- Order from 1-10 the following processes as they occur during DNA replication of the lagging strand. a. DNA ligase adds a phosphodiester bond between the adjacent nucleotides. b. Single-strand-binding proteins (SSB) hinder the DNA from reforming the double
- What is the function of topoisomerase? A) Relieving strain in the DNA ahead of the replication fork. B) Elongating new DNA at a replication fork by adding nucleotides to the existing chain. C) Unwinding of the double helix. D) Stabilizing single-stranded
- If you removed one component from Replisome and started replication and saw that replication synthesis occurred only on leading strand (not on lagging strand), which of the components was it? 1) DNA Pol III core subunits. 2) Helicase. 3) Gyrase. 4) B-clam
- For DNA polymerase to begin replication, the primer used in Sanger sequencing A. can have any nucleotide sequence. B. will have a complementary sequence to the 3' end. C. will have a complementary sequence to the 5' end.
- The enzyme responsible for proofreading a growing DNA strand and for replacing mismatched nucleotides is: A. helicase B. DNA ligase C. topoisomerase II D. DNA replicase E. DNA polymerase
- What proteins are crucial for creating and maintaining DNA replication forks? a. Helicase creates the replication fork; primase keeps the single strands from closing shut. b. Helicase creates the replication fork; single-strand binding proteins keep the s
- Assume a length of DNA that has just one replication origin at its centre and is 3 billion nucleotide pairs in length with a replication speed of 100 nucleotides per second. How long would it take to replicate? How many equally spaced replication origins
- The enzyme responsible for proofreading a growing DNA strand and for replacing mismatched nucleotides is: a. DNA ligase. b. topoisomerase II. c. DNA polymerase. d. DNA replicase. e. helicase.
- In DNA replication, _________. A) A new non-coding strand is made for the gene. B) A new gene is made for the non-coding strand. C) Both of these occur. D) None of these occur.
- If you start with one chromosome prior to DNA replication, how many DNA helices do you have when replication is complete?
- For each of the following describe its role in DNA replication of bacteria: a) Origin of replication. b) DNA B (a helicase). c) Single-stranded binding protein (SSB). d) Primase. e) DNA polymerase III. f) Tus protein.
- DNA replication is semi-conservative. Explain events within the process of DNA replication.
- What step in DNA replication precedes the pairing of complementary bases? A. Separation of the two strands. B. Mitotic division. C. Joining of the two strands. D. Polymerization of DNA. E. Formation of the histone core.
- Answer this question in reference to the replication fork that would be on the the left side of a replication bubble. The Okazaki fragments are necessary for which part of DNA synthesis? A. Elongation of the leading strand as it grows toward the replic
- After combining DNA fragments in a cloning experiment, ______ is used to covalently join the DNA segments. A. restriction enzyme B. DNA Ligase C. reverse transcriptase D. DNA polymerase E. helicase
- Choose the best answer: The two strands of a DNA helix are initially separated during the process of DNA replication by a. DNA polymerase I. b. DNA polymerase III. c. a topoisomerase. d. primase. e. helicase.
- The function of DNA ligase is to: a) facilitate base pairing between single stranded molecules of DNA. b) catalyze the formation of hydrogen bonds between adjacent nucleotides. c) unwind the double-stranded DNA prior to replication. d) catalyze the format
- DNA replication of a single DNA molecule is referred to as semiconservative because A. each of the two DNA molecules will consist of one parental strand and one newly synthesized strand. B. all the DNA strands in the two DNA molecules will have both par
- Bacterial cells use DNA replication to: A. make backup copies of their genome in case of a mutation. B. manifest multiple phenotypes at once. C. copy their genetic material prior to binary fission. D. build functional proteins.
- When DNA is replicated, the two strands are first separated through breakage of ....; each strand then becomes a .... against which two new strands are made.
- Telomerase uses RNA: (a) As a primer for DNA replication at the ends of chromosomes. (b) As a template to add DNA to the ends of chromosomes. (c) As a primer for synthesis of Okazaki fragments. (d) As a riboswitch to control termination of DNA synthesis a
- Why does each replication fork require both leading and lagging strand synthesis? Select two reasons below. A) Because DNA synthesis is semi-conservative. B) Because DNA polymerases must synthesize DNA 3' to 5'. C) Because the DNA templates are antiparall
- DNA repair enzymes preferentially repair mismatched bases on the newly synthesized DNA strand, using the old DNA strand as a template. If mismatches were simply repaired without regard for which strand serve as template, would mismatch repair reduce repli
- Spontaneous mutations arise when DNA replication does not occur properly. Which of the following would be an indication that DNA replication is NOT occurring properly? a. You isolate replication products during the replication process and find that your
- What are DNA topoisomerases responsible for? a) relieve the tension that builds up in front of a replication fork b) none of these answers c) joins together Okazaki fragments on the lagging strand during DNA synthesis d) an enzyme that synthesizes RNA
- What proteins are crucial for creating and maintaining DNA replication forks? a. Helicase creates the replication fork; ligase keeps the single strands from closing shut. b. Helicase creates the replication fork; primase keeps the single strands from clos
Explore our homework questions and answers library
Browse
by subject