Explain why insertion and deletion mutations generally have devastating effects on encoded proteins.
Question:
Explain why insertion and deletion mutations generally have devastating effects on encoded proteins.
Frameshift Mutations
Suppose we had a gene with the following mRNA nucleotide sequence:
 |
As a result of an insertion of a cytosine early in the sequence, the reading frame has been shifted. That is, the way the ribosome will translate each codon has shifted by one nucleotide, resulting in a whole different sequence of amino acids that will be translated in addition to an early stop codon.
Answer and Explanation: 1
Become a Study.com member to unlock this answer! Create your account
View this answerInsertion and deletion mutations can have more devastating effects on encoded proteins because, unlike point mutations that can cause a single amino...
See full answer below.
Ask a question
Our experts can answer your tough homework and study questions.
Ask a question Ask a questionSearch Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
Frameshift Mutations | Types, Examples & Effects
from
Chapter 12 / Lesson 4
222K
What is a frameshift mutation in DNA coding? Review the types of mutations, and find out what causes a frameshift mutation and some examples of their effects.
Related to this Question
- Explain why all mutations are not necessarily harmful? Does changing the sequences of nucleotides always result in a different amino acid sequences?Explain.
- Explains why all mutations are not necessarily harmful? Does changing the sequences of nucleotides always result in a different amino acid sequence? Explain.
- Explain how some DNA mutations cause no effect on the resulting protein, others alter the protein's function and still others cause the protein to stop functioning all together. Also, give an example of an original DNA sequence and two mutations of that
- Explain why all mutations are not necessarily harmful. Does changing the sequence of nucleotides always result in a different amino acid sequence? Explain. Explain the differences between a point mu
- What is the effect of mutations on the structure of proteins?
- Explain why the deletion of a single nucleotide in a gene (a frameshift mutation) generally results in more severe defects in the polypeptide than a point mutation that just changes a single nucleotide.
- Explain how one type of mutation might affect the protein produced by a given gene in a bad, good, and neutral way. Explain the effect at each step of transcription and translation.
- How would a mutation that inserts 3 nucleotides into a DNA sequence affect protein formation? a. Major damage - the entire sequence of amino acids is disrupted, and the protein has none of the amino acids it was supposed to b. Some damage - an extra amino
- Cells have several molecular mechanisms that repair DNA damage and mutations. Despite this, mutations still occur. Explain why.
- Why is a deletion or addition referred to as a "frame-shift" mutation? a. The insertion or deletion of nucleotide base pairs adds an extra amino acid to the protein. b. The insertion or deletion of nucleotide base pairs does not have any effect on the
- Briefly explain why silent mutations in the DNA sequence of a gene do not alter the function of the protein product of that gene.
- Explain why changes in the nucleotide sequence could result in the production of different proteins. Be specific and include the impacts on the protein production process.
- How does the point of mutations affect the protein synthesis (missense, nonsense, frameshift mutations)?
- What is the mutation type that is the least likely to alter the amino acids in a protein? a. insertion b. deletion c. substitution Which of those mutations is most likely to be dangerous?
- Explain why a single base deletion could be potentially more damaging to protein synthesis than a deletion of three consecutive bases confined to one triplet.
- Which is likely to be more deleterious, a 1bp deletion from an exon in the coding sequence of a gene, or a 3bp deletion? Explain clearly what all the potential consequences of both deletions could be on the proteins amino acid sequence.
- What could be the effect of deletion, substitution, or addition that alters the sequence of the stop codons?
- Explain the effect of adding or deleting a base-pair to the generation of a protein.
- Name three possible ways a mutation may affect intron splicing and how the resulting protein may be affected.
- How do mutations affect polypeptide structures and their function?
- An insertion or deletion mutation leads to a ______ and will result in a nonfunctional protein due to an insertion or deletion of 1 or 2 bases
- Does every mutation that causes a nucleotide base change also cause a change in the amino acid sequence of a protein? Explain.
- How does DNA ultimately control the functioning of cells? How/why can mutations in DNA disrupt proper functioning?
- Which DNA mutation is more likely to have a detrimental effect on the protein it codes for: a 1 base pair deletion from the middle of the coding sequence of a gene or a 9-base pair deletion from the same region of the gene? Explain why?
- How does a genetic mutation occur? a. Base pairs are deleted or inserted along with the DNA. b. The nucleus signals for a mutation to occur. c. Introns are removed from the genetic sequence. d. Genetic mutations occur systematically.
- Be able to describe the function of all the proteins in the replisome - what would happen if there was a mutation in any one of these proteins?
- What are the effects of a mutation on the genetic code on protein and on protein function?
- How would a point mutation in an intron affect a protein?
- When a cell is exposed to ethidium bromide, the resulting DNA damage is likely to cause what type of mutations? a. Insertion b. Substitution c. Deletion d. Both inversion and insertion e. Both insertion and deletion
- A) Why doesn't RNA polymerase have to proofread, or more specifically why isn't it detrimental to the cell? B) Also, how would an enzyme using RNA as a template for DNA synthesis alter the rate of mutations?
- How will the following mutations affect transcription initiation of the trip operon? \\ A. A mutation that deletes that trpR gene B. A mutation that deletes trpO C. A mutation that prevents the trypressor from binding tryptophan
- List four outcomes that result from a Base Substitution in the middle of the gene. (1st) Explain the effect that the mutation has on the Amino Acid, and why it has that effect. (2nd) Explain the effect on the Protein due to that mutation.
- Summarize how the insertion of a nucleotide in a DNA sequence can change the effectiveness of a protein.
- What effect would the deletion of a single nucleotide in a DNA sequence encoding a gene affect the process of transcription and the resultant mRNA sequence?
- Why is it important to remove proteins in a DNA extraction procedure?
- What are mutations and their impact on a DNA sequence?
- Explain the ramifications to the process of transcription if the following occurs: The termination sequence of a gene is removed
- Which of the following mutations have the most significant effect on protein synthesis? a. Base pair substitutions b. Silent mutations c. Intron mutations d. Frameshift mutations
- Why have cells evolved to inhibit gene transcription?
- Is a chromosome deletion equivalent to a frameshift mutation? Why or why not?
- A mutation in the DNA causes a 3 bp insertion into exon sequences of the gene. What is the impact, if any, on the protein encoded by gene A? a. There is no impact, as exons are spliced out and not found in the mRNA. b. All the amino acids after the 3 bp i
- A mutation has occurred in the promoter sequence of a gene. Briefly explain what effect that mutation will likely have on the transcription of the gene.
- Describe how a single nucleotide change can have vastly different effects on a protein function.
- Explain why it would be advantageous for multiple codons for specific amino acids.
- Explain how one change in a DNA nucleotide could alter the sequence of amino acids in the resulting protein. (An example would be the difference between normal and sickle-cell hemoglobin.)
- Briefly explain how a point mutation in the DNA sequence of a gene can alter the function of the protein product of that gene.
- Describe chromatin remodeling via histone methylation and discuss it's effect on the transcription process.
- How would protein synthesis execute differently if there is a mutation?
- Are the mutations that cause Huntington's disease the result of a mistake in DNA replication or transcription? Explain.
- Describe how chromatin structure (DNA methylation and histone modification) can affect gene expression.
- Why does a genetic abnormality affect protein synthesis? a. The genetic sequence controls the expression of genes. b. Nucleotide sequences create proteins. c. Protein synthesis does not respond to change during expression. d. Correct genetic sequences det
- Describe how a change in DNA sequence could result in a changed sequence of amino acids in a protein.
- Consider the consequences of a mutation in the DNA template sequence 5'ATG3' to 5'TTG3'. What is (a) the resulting change in the mRNA codon and (b) the effect on the corresponding amino acid?
- A genetic mutation was found in the gene that encodes for pendrin, rendering this protein largely nonfunctional. Explain what syndrome would result and how (molecular events).
- Are the mutations that cause Huntington's disease present in the DNA, RNA, or both? Explain.
- How does mutation in telomerase impact DNA replication in dyskeratosis congenita?
- Why is DNA replication critical? Choose one enzyme and describe its function for DNA replication. List and describe the effects of the following mutations: deletion, missense, and nonsense.
- Explain how the sequence of DNA impacts the function of the gene.
- How can changing the DNA of organisms lead to change in the structure of one of this organisms's proteins? Why does changing the structure of protein matter?
- How does bacterial DNA enter the cell? And why isn't it destroyed before that?
- If a mutation occurred that increased the number of introns in a sequence of DNA, what impact would this have on the protein formed from the gene? A. It would change the shape. B. It would change the function. C. it would have no effect. D. Both A and B
- Explain why a redundant genetic code helps protect an organism from the effects of mutations. Cystic fibrosis is caused by a mutation in the 250,000-bp CFTR gene. The mature CFTR mRNA is only 6129 nuc
- Discuss the effects of histone modification and DNA modification on transcription. Describe ways in which marks can activate and repress transcription for both types of modification. For all modificat
- In essay form, explain why changes in nucleotide sequence could result in the production of different proteins. Be specific and include the processes and impacts to the protein production process.
- Which of the following mutations could result in a truncated protein? Choose all that apply. a. A nonsense mutation that changes a cysteine to a stop codon b. A chromosomal-level deletion c. A chromos
- Describe how the RNA transcript is modified before it can be used to make proteins.
- What happens when a mutation results in an amino acid substitution?
- Which type of mutation is most likely to drastically affect a protein's sequence? (a) silent mutation (b) Missense mutation (c) Insertion of three nucleotides (d) Deletion of three nucleotides (e) Insertion of one nucleotide.
- Identify the following: An insertion or deletion mutation that completely alters the reading of every single codon downstream from it in a strand of DNA, producing a completely altered protein.
- Discuss how alternative splicing and RNA editing can generate protein diversity in eukaryotes.
- List the seven types of proteins and explain in detail, how each specific mutation increases the risk for cancer?
- What happens if a mutation causes a tRNA to be charged with the wrong amino acid?
- Explain why every replication of a linear molecule of DNA leads to a shortening of the DNA molecule.
- Restriction enzymes do not destroy the DNA of the same organism that makes them, why?
- What are the effects of a nonsense mutation in a gene coding for a protein that is vital for the activity of ATP synthase in the mitochondria? What would the impact of this mutation in the ATP synthase gene be on its DNA structure, and on transcription an
- Are the mutations that cause sickle cell anemia present in the DNA, RNA, or both? Explain.
- Mutations are changes in the DNA sequence of a cell. Describe two ways in which a mutation in the genome of a cell does not affect any cellular activity.
- What mutagen causes mutations by substituting for one of the nucleotides (nitrogen bases) normally found in DNA? Explain.
- Why is a deletion of an inhibitor of a transcription activator recessive?
- An addition or deletion mutation that results in all of the amino acids after the mutation being wrong is called what?
- Fill in the blank. The mutation which results in the loss of nucleotide pairs in a gene; has a major effect on the resulting protein is termed as ______.
- a) Identify, and explain at least 4 actions that can result in changes in chromosome structure. b) Explain why changes in nucleotide sequence could result in the production of different proteins.
- Describe how the following mutation will affect the final protein product. Name the type of mutation. Original template strand: 3' CGTTACCCGAGCCGTACG ATTAGG 5' Mutant strand: 3' CGTTACCCGAGCCGTAACGATTAGG 5'
- Why are there sometimes errors as DNA copies itself during cell division which causes mutation?
- What is a mutation? a. A variation in DNA sequence that always has negative consequences b.A variation in RNA sequence that affects the production and/or shape of proteins c.A variation in RNA sequence that causes malfunctions in the cell cycle d. A var
- Explain why mismatches are rare after DNA replication.
- What is mutation of the DNA? Why does it happen? What can happen if there is mutation of DNA for the production of proteins? What are some examples?
- Why is it necessary to study mutations in both exon and introns?
- How would the insertion of a nucleic acid into an mRNA sequence affect the process of translation and the resultant amino acid sequence?
- What would happen to a cell that had a mutation that caused all of the ribosomes to stop functioning? Why? Be sure to thoroughly explain your answer.
- What effect does mutation at nucleotides within a silencer element have on the expression of the gene associated with the silencer? Why does it have this effect?
- Explain P53's role in preventing cells with DNA damage from replicating.
- How does mutation change the protein (HFE)?
- Some mutagens can insert into DNA and cause frameshift mutations. How would the effect on the amino acid sequence of a frameshift mutation differ between an overlapping and a nonoverlapping code?
- What would be the impact of a mutation that eliminates transcription factor (tf3) on the expression of gene 2 (g2)? A. It would produce more transcripts if tf1 and tf2 were active. B. It would be inactivated. C. If it has a strong promoter, it will be con
- Describe the frameshift mutation and transcribing DNA into mRNA.
- Describe how proteins bound to enhancers and silencers can regulate genes far away.
- Discuss one way in which DNA mutations are repaired by the cell.
- Explain how restriction enzymes enable genetic engineering.
- Explain the relationship between DNA replication and the generation of mutations.
Explore our homework questions and answers library
Browse
by subject