Explain how a cell builds proteins, beginning with DNA and ending with our final protein product....
Question:
Explain how a cell builds proteins, beginning with DNA and ending with our final protein product. Why are proteins important in proper body functioning?
Proteins:
Proteins are biological molecules that are essential for carrying out various functions like catalyzing biochemical reactions, transporting oxygen, and providing defense against infections. They act as building blocks in cartilages and help in packing the DNA molecules.
Answer and Explanation: 1
Become a Study.com member to unlock this answer! Create your account
View this answerProteins are produced within the cells of the body. Protein synthesis in cells occurs in two main steps that are transcription and translation. During...
See full answer below.
Ask a question
Our experts can answer your tough homework and study questions.
Ask a question Ask a questionSearch Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
Proteins Lesson for Kids: Definition & Facts
from
Chapter 4 / Lesson 10
25K
Learn about proteins, a type of organic molecule. Discover how amino acids create proteins, what parts of the body are made of protein, and what foods provide the body with protein.
Related to this Question
- Why are proteins important in your body and how to make a protein from DNA?
- Explain the steps of protein formation beginning with DNA and ending with the finished protein. Then explain how proteins help regulate the movement of material into and out of the cell.
- Give 3 reasons why proteins are not made directly from DNA.
- Explain how DNA, through the process of protein synthesis, is responsible for the ultimate expression of the characteristics in the organism.
- Explain the steps of protein formation beginning with DNA and ending with the finished protein.
- Why does DNA have to turn into RNA before it can make a protein? Why can't DNA just make the proteins itself?
- DNA is the blueprint not only for the organism but for all the parts of the cell. How does DNA dictate the functions of a particular cell (by the production of proteins)? How does a cell produce proteins?
- Describe the basic structure of DNA. Discuss why DNA is often called a "protein recipe".
- Why does a cell contain many more proteins than there are protein-coding genes?
- How are DNA, protein, and carbohydrates involved in the structure of your cells?
- How can changing the DNA of organisms lead to change in the structure of one of this organisms's proteins? Why does changing the structure of protein matter?
- Why does DNA not form protein directly? Why does DNA depend on RNA?
- Describe how DNA results in a functional protein in the cell. Choose an actual protein and trace it through the process of transcription and translation to its final destination (does it remain within the cell to do work? outside of the cell? A different
- Select the correct answer. How is DNA linked to the production of proteins? A) Proteins hold the instructions on how to make DNA. B) DNA is the end point of protein production that allows cells to finish making proteins. C) DNA is not linked to the produc
- How does cell chemistry, and therefore all life, depend on the production of proteins? What role do genes, RNA, and DNA play in the production of proteins?
- How is DNA information used to make proteins?
- Enzymes are proteins. Define a protein and explain how the tertiary structure of a protein determines the protein's overall shape and function.
- Describe the structure of DNA and how it complexes with proteins for packing.
- Explain how DNA codes for traits. (Discuss RNA and proteins in your answer.)
- Explain how DNA codes for traits. Be sure to discuss RNA and proteins in your answer.
- Explain how some DNA mutations cause no effect on the resulting protein, others alter the protein's function and still others cause the protein to stop functioning all together. Also, give an example of an original DNA sequence and two mutations of that
- Explain what codons are and how are they used to build protein. How is that information stored in DNA? How is that information used to carry out life processes?
- How does DNA control the cellular or organism structure and function?
- Describe how DNA, a specific genetic information, results in the formation of a protein.
- How does DNA direct the making of a protein?
- Why is protein structure such an important topic in biology and chemistry?
- Explain how the process of transcription and translation makes proteins from DNA. Use the following terms in your explanation: template strand, RNA polymerase, nucleus, mRNA, cytoplasm, ribosome, tRNA, amino acid, peptide bond, growing protein chain, codo
- Prior to the discovery of DNA as the molecule carrying our genetic information, why were proteins more commonly believed to perform this important task?
- Describe the structure of DNA and the steps of protein synthesis.
- Please explain the following: 1. The biochemical structure of DNA. 2. How DNA replicates? 3. How the DNA structure forms the genetic code? 4. How that genetic code comes to be expressed as a phenotyp
- Explain the roles of cell signaling in DNA, transcription, and protein synthesis.
- Why has gene flow been a particularly important evolutionary process for humans? Discuss the major steps in protein synthesis.
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events, and enzymes in your answer. Use the following DNA molecule to illustrate each stage. 3' TACTAG
- Explain how protein synthesis, mutation, and meiosis are fundamental to the process of evolution.
- Explain the outline of the mechanisms in which DNA is used to generate protein. (ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells)
- Explain how proteins coded in the nuclear genome are transported to different membrane-bound structures in the cell.
- How does the cell use the information contained in the DNA to construct proteins (transcription and translation)?
- Explain why proteins "fold" after they are produced.
- (a) Describe the levels of DNA packaging. (b) Why is this important to the cell?
- a) Describe and explain the mechanisms in which DNA is used to generate protein. b) Identify and explain any major differences between the mechanisms in prokaryotic and eukaryotic cells.
- How can the structure and function of nucleotides (DNA and RNA) allow the cell to assemble specific proteins with different structures and functions?
- _____ are pieces of DNA that instruct a cell how to make proteins.
- Explain why changes in the nucleotide sequence could result in the production of different proteins. Be specific and include the impacts on the protein production process.
- Why is DNA the genetic material, instead of RNA, proteins or carbohydrates?
- Explain the link between DNA sequence and protein structure and function.
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage. 3' TACTAGCCACATCTACCGATC
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events, and enzymes. Use the following DNA molecule to illustrate each stage. 3' TACTAGCCACATCTACCGA
- Explain how DNA is packaged or organized within the cell.
- What is the role of DNA and RNA in protein synthesis? Explain your answer.
- DNA is the blueprint not only for the organism, but also for all the parts of the cell. How does DNA dictate the functions of a particular cell?
- Describe the process of protein synthesis, starting with the DNA, stored in the nucleus, and ending with the completed protein. Be sure to mention the terms code, codon, anticodon, mRNA, tRNA, amino acids, and ribosomes in your answer.
- How does information coded in DNA get converted into a protein? Name the major processes, the major cellular structures and the major molecules involved.
- Why is the flow of information from DNA to RNA to protein? Do ribosomes create protein?
- Explain how the structure of DNA is well-suited for replication and its function.
- How do DNA and ribosomes direct protein production in cells? Give examples.
- Why is it important to understand the chemical properties of amino acid side chains in order to understand protein structure and function?
- Explain how protein-protein interactions are important for the biological function of the following types of proteins: A. Receptors. B. antibody. C. Proteases. Mention an example of each type of protein and its interaction partners.
- How are DNA, RNA, and proteins related in the cell?
- Why is DNA better than RNA as genetic material? Explain.
- How do the proteins of the transcription machinery access DNA that is tightly associated in chromatin?
- Describe how translation produces the primary structure of a protein.
- List the steps involved in protein synthesis, beginning with the DNA code in the nucleus and ending with a polypeptide. Explain in 10 steps.
- How does primary protein structure affect the function of protein enzymes?
- Briefly describe what you know about the structure of DNA and how DNA is packaged in a cell.
- How the structure of DNA contributes to a cell's ability to replicate it?
- Explain how DNA encodes a cell's information.
- Explain how the evolution of the endomembrane system gave rise to a new type of protein synthesis in cells.
- Suppose you know the amino acid make-up of specific proteins in a cell. How would you determine the particular DNA code that coded for them. Explain how one change in a DNA nucleotide could alter the formation of the translated protein AND what effect it
- All living organisms, including bacteria, plants, humans and other animals, are made up of one or more cells. Explain why all living organisms need to have DNA. Include the words, genes and proteins, in your explanation.
- What is the role of DNA in protein synthesis?
- What are proteins? How can the diversity of proteins in living organisms be explained?
- (a) What are proteins? (b) How can the diversity of proteins in living organisms be explained?
- What are proteins? How can diversity of proteins in living organisms be explained?
- Explain the function of all molecules involved in DNA replication.
- Briefly explain how a point mutation in the DNA sequence of a gene can alter the function of the protein product of that gene.
- How does DNA ultimately control the functioning of cells? How/why can mutations in DNA disrupt proper functioning?
- How are genes (and protein production) regulated?
- Describe the process of protein synthesis in a cell. Correctly include the following terms: ribosome, t-RNA, DNA, m-RNA, amino acid, polypeptide, and ATP.
- A certain small enzyme is needed to extracellularly digest food. The order of the bases on the DNA molecule is ACCAAATCGTTC. What is the order of amino acids on the protein? Explain from start to finish the process by which this protein is created and e
- How do transcription enzymes know the sequence of DNA that is to be translated into a required protein?
- Describe all the circumstances that guide a protein to its proper structure for its function. Which of these is the most important for protein folding?
- Explain why all genes are not expressed in all cells.
- Explain how a protein ends up with its final shape. What would happen to an enzyme's ability to function if a mutation changed the order of some of the amino acids in its polypeptide chain?
- Be able to describe the function of all the proteins in the replisome - what would happen if there was a mutation in any one of these proteins?
- How is stored genetic information used to produce an active protein in the cell?
- Why do mutations affect the primary structure of a protein?
- Can you explain the DNA-RNA-PROTEIN concept?
- Explain how proteins are modified after they are translated and how they are sorted to various locations in the cell.
- Explain how DNA will be paired with mRNA and make the protein by genetic code. EXAMPLE: TACGCAACACGAGATTTAGGTTGGTAGTGGCAC
- How do changes in DNA lead to changes in protein and impact on cellular activity? Give examples.
- Do all proteins have quaternary structure? Explain why or why not and provide an example of a tertiary and quaternary structured protein.
- Why don't DNA directly translate into protein?
- Provide one example of a non-sequence-specific DNA binding protein and explain its function.
- Provide one example of a sequence-specific DNA binding protein and explain its function.
- How would one explain the phrase "all proteins are enzymes but not all enzymes are proteins"?
- Protein synthesis (involving Transcription and Translation) is important in eukaryotic cells. Please explain the two basic processes starting with the cell nucleus and the synthesis of mRNA, and ending with the formation of a peptide for export.
- Briefly explain why silent mutations in the DNA sequence of a gene do not alter the function of the protein product of that gene.
- What is the process of protein synthesis? How does it relate to DNA replication and the creation of RNA?
- Begin with the information in DNA, a specific gene. Describe how this genetic information results in the formation of a protein.
- Begin with the information in DNA, a specific gene, and describe how this genetic information results in the formation of a protein.
Explore our homework questions and answers library
Browse
by subject