Briefly describe how transcription, phosphorylation, protein-protein interactions, and...
Question:
Briefly describe how transcription, phosphorylation, protein-protein interactions, and proteasome-mediated turnover are involved in cell cycle regulation.
Cell Cycle Regulation:
Any procedure that governs the sequence of activities that happen as a cell passes within a cell cycle. A cell duplicates its DNA and other components and divides in half during the cell cycle.
Answer and Explanation: 1
Transcription is an important part of the process in cell cycle regulation because transcription factors can turn on and off genetic variations based on what is required at the time. Phosphorylation is also important for regulating the signaling of different routes used during the cell cycle. Proteins are important because cell cycle regulatory proteins assistance monitor and controlling cell cycle progression through their interactions with transcriptional regulators. Proteasomes are enzymes that govern the number of proteins that control cell cycle progression.
Ask a question
Our experts can answer your tough homework and study questions.
Ask a question Ask a questionSearch Answers
Learn more about this topic:
Get access to this video and our entire Q&A library
Difference Between Cell Cycle and Mitosis
from
Chapter 5 / Lesson 5
33K
Learn about the cell cycle and mitosis. Discover the purpose of the cell cycle and mitosis, examine the 4 phases of the cell cycle, and study the mitosis cycle.
Related to this Question
- Describe how transcription, phosphorylation, protein-protein interactions and proteasome-mediated turnover are involved in cell cycle regulation.
- eukaryotic gene regulation: \\ Transcription factors are sometimes activated by phosphorylation as in the MAPK pathway. Explain how this links an extracellular hormone signal to eukaryotic gene transcription. Be specific.
- Explain what transcription factors and regulatory proteins are and how they regulate gene expression in eukaryotes.
- Describe an example of how transcription is controlled in prokaryotes and an example of how transcription is controlled in eukaryotes.
- Describe Transcription, such as . . . What are the 3 steps involved What enzyme is used How does prokaryotic transcription differ from eukaryotic transcription . . .etc.
- Describe the process of transcription of mRNA in a eukaryotic cell.
- Explain how the process of transcription and translation makes proteins from DNA. Use the following terms in your explanation: template strand, RNA polymerase, nucleus, mRNA, cytoplasm, ribosome, tRNA, amino acid, peptide bond, growing protein chain, codo
- Describe the transcription and translation that happens during protein synthesis.
- Describe the biochemical composition, structure, and replication of DNA. Detail the role of specific RNAs in the process of protein transcription and translation.
- Describe a protein-protein interaction necessary for transcription to proceed.
- Describe transcription control in the Arabinose (araBAD) operon.
- Describe the regulation of gene transcription, especially the involvement of various DNA sequence elements, protein factors, and non-protein factors in the regulation process.
- Explain the roles of cell signaling in DNA, transcription, and protein synthesis.
- How does transcription occur? Describe its steps and directionality.
- Explain how CREB protein is being regulated to activate gene transcription and how a specific transcription control gene expression? Name each step.
- Describe an operon, the regulatory proteins, the cellular process and the molecules being "sensed".
- Microbiologists describe the processes of transcription and translation as coupled in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bac
- Explain the steps of protein formation beginning with DNA and ending with the finished protein. Then explain how proteins help regulate the movement of material into and out of the cell.
- Describe how DNA results in a functional protein in the cell. Choose an actual protein and trace it through the process of transcription and translation to its final destination (does it remain within the cell to do work? outside of the cell? A different
- Describe the various steps involved in the initiation of replication in eukaryotes. What proteins are involved in each of the steps, and when in the cell cycle does each of them occur? How does their temporal segregation contribute to the limitation of or
- Describe the central dogma of molecular biology. Briefly describe the processes of transcription and translation.
- Describe the allosteric regulation model for transcription termination and briefly indicate how this model can explain both Rho dependent and Rho independent termination reactions.
- Relating to biology, explain the term 'transcription'.
- In general terms, explain how chromatin organization can regulate gene expression at the transcription level.
- Describe the process of DNA replication, protein synthesis (including transcription and RNA processing) and translation.
- Describe the mechanism of action of cycloheximide and, briefly, explain how it can be used to study the synthesis and degradation of proteins.
- Enzymatic activity can be regulated by gene transcription. Explain how this influences the activity of enzymes in general.
- Describe the events and molecules involved in the process of transcription.
- Describe the manner in which the DNA can be transferred from one cell to another by explaining and describing the following mechanisms in prokaryotes: transformation, conjugation, and transduction.
- Briefly describe the process of protein synthesis.
- Describe the process of translation and transcription in the cell.
- Describe how the process of DNA transcription occurs.
- Describe the process of transcription and messenger RNA processing in eukaryotic cells.
- Describe the process of gene regulation in eukaryotes.
- 1) Explain transcription and translation in detail 2) Explain DNA replication 3) Explain epigenetics
- Describe the process of transcription. Include the names of all molecules involved and what they do; location, enzyme, 5' and 3'.
- Explain about the different steps involved in gene transcription process.
- 1- What is the purpose of the mRNA transcript? 2- Explain why term 'transcription' is used to describe this part of the process cells use to make proteins.
- a-What is the purpose of the mRNA transcript? b-Explain why the term ''transcription'' is used to describe this part of the process cells use to make proteins.
- Describe the stages of gene transcription. Genes have special internal DNA sequences that form hairpins and specify a transcription pause. Explain in a mechanistic manner how these sequences affect the rate of transcription and discuss their potential ben
- Describe the basics of transcription and translation. Where in human cells does each of these processes occur?
- What is transcription? Describe the process of transcription. Where does it occur? What enzyme(s) are involved? What is the product(s)?
- The rate of transcription of the trp operon in E. coli is controlled by what two regulatory processes? These two processes can regulate the trp operon up to about _____-fold due to the combined effects of these processes. By what mechanisms do these two r
- Explain what Tsix is in genes and its role in either the translation, transcription, or replication process of the cell.
- How are prokaryotes and eukaryotes different in terms of the RNA polymerases involved in transcription?
- Briefly describe what happens during transcription.
- Describe the steps of transcription and translation in a eukaryotic cell.
- Relating to biology, explain the term 'transcription unit'.
- Explain the process of RNA interference and how it regulates gene expression.
- What is transcription? Why is it necessary? Where in the cell does it occur? What are the 3 steps involved? What enzyme is used? How does prokaryotic transcription differ from eukaryotic transcription?
- Describe the function of helicase in lagging strand synthesis in DNA synthesis.
- Explain how protein-protein interactions are important for the biological function of the following types of proteins: A. Receptors. B. antibody. C. Proteases. Mention an example of each type of protein and its interaction partners.
- Explain specifically how the RNA interference pathway works, fully describing the roles of key enzymes and target molecules.
- Protein synthesis (involving Transcription and Translation) is important in eukaryotic cells. Please explain the two basic processes starting with the cell nucleus and the synthesis of mRNA, and ending with the formation of a peptide for export.
- Describe the role of RNA polymerase in the transcription process.
- Describe a protein-protein interaction necessary for replication to proceed.
- Describe how the DNA code is read through the processes of Transcription and Translation.
- Relating to biology, explain the term 'reverse transcription'.
- How does transcription take place in prokaryotes?
- Describe levels of chromatin structure and explain how chromatin is decondensed to allow transcription.
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events, and enzymes. Use the following DNA molecule to illustrate each stage. 3' TACTAGCCACATCTACCGA
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage. 3' TACTAGCCACATCTACCGATC
- Describe the process of protein synthesis in a cell. Correctly include the following terms: ribosome, t-RNA, DNA, m-RNA, amino acid, polypeptide, and ATP.
- Explain nucleic acids and gene expression by describing the structure of DNA and RNA, explaining DNA replication, and explaining the flow of genetic information in eukaryotic cells. Use the terms transcription and translation in your response.
- Describe the process of transcription.
- Explain the relationship and component parts of translation and transcription in eukaryotes.
- How are enzymes involved in the process of genetic transcription?
- a) How is DNA transcription different than DNA replication/synthesis? b) What is the role of messenger RNA (mRNA) during DNA transcription? c) What happens to the mRNA after transcription is complete (i.e., where does it go)?
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events, and enzymes in your answer. Use the following DNA molecule to illustrate each stage. 3' TACTAG
- Describe how the RNA transcript is modified before it can be used to make proteins.
- A) What is the process of transcription? B) What is the role of mRNA and how does it relate to DNA?
- Microbiologists describe the processes of transcription and translation as "coupled" in bacterial cells. This term indicates that a bacterial mRNA can be undergoing transcription at the same time that it also is undergoing translation. a. How is the coup
- Why does the transcription of genes need to be regulated? Describe three different strategies for transcriptional regulation.
- What is the process of protein synthesis? How does it relate to DNA replication and the creation of RNA?
- Answer of the following question. Describe how the trp operon functions in prokaryotic gene transcription.
- (a) Describe the processes of transcription and translation. (b) List the role of RNA.
- Describe the steps of Reverse transcription polymerase chain reaction (RT-PCR).
- (a) Describe the steps involved in transcription. (b) Describe the steps involved in translation.
- Once the transcription is complete, another form of gene regulation can occur by how a finished mRNA is routed within the cytoplasm. On what part of an mRNA molecule are found base pair sequences that influence its routing? a. The base pairs flanking the
- How do replication, transcription, and translation work, and how are they different or similar between prokaryotes and eukaryotes?
- a) Describe and explain the mechanisms in which DNA is used to generate protein. b) Identify and explain any major differences between the mechanisms in prokaryotic and eukaryotic cells.
- Describe the structure of DNA and the steps of protein synthesis.
- Describe the ways in which replication differs from protein synthesis .
- Describe the process of RNA splicing in eukaryotic cells.
- Explain why simultaneous transcription and translation can happen in bacteria but not in eukaryotes.
- Describe some of the general ways in which (specific) transcription factors are regulated and how they, in turn, can regulate gene expression
- How do the proteins of the transcription machinery access DNA that is tightly associated in chromatin?
- How does transcription occur, and what are its steps and directionality?
- Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
- Compare and contrast (how are they the same and how are they different) the processes of eukaryotic transcription with translation. How does each process work and what enzymes are used for each?
- Explain the order of transcription (ribosomes and enzymes creting more dna strands).
- Describe how the structure of DNA allows it to be copied, and what enzyme performs this function. Describe how a messenger RNA (mRNA) transcript is made using DNA as a template. Describe how the infor
- Describe the process of translation of prokaryotes and eukaryotes in a single, concise paragraph. In doing so, use the following terms: tRNA, peptide bond, rRNA, mRNA, start codon, stop codons, triplet code, genetic code, codon, anticodon, ribosome.
- Describe how the structure of DNA allows it to be copied, and what enzyme performs this function. Describe how a messenger RNA (mRNA) transcript is made, using DNA as a template. Describe how the info
- How are the leading and lagging strands different from one another in prokaryotes, how exactly are they synthesized and what enzymes are involved?
- The function of RNA to DNA include the replication, transcription, and translation. Explain these three processes.
- Describe how RNA and DNA are used in mitosis.
- Describe the function of helicase in leading strand synthesis in DNA synthesis.
- (a) What is an operon? (b) Describe how the lac operon works to control lactose catabolism.
- Explain the different stages at which the expression of genes into proteins can be regulated by a cell.
Explore our homework questions and answers library
Browse
by subject